IthaID: 210

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Benign / Likely Benign
Common Name:	IVS II-613 (C>T)	HGVS Name:	HBB:c.316-238C>T
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
TACAATGTATCATGCCTCTTTG [C/T] ACCATTCTAAAGAATAACAGTG (Strand: -)

Also known as:

Comments: Additional cases reported with Indian and Malay origin.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

LOVD

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	Unclear
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	71652
Size:	1 bp
Located at:	β
Specific Location:	Intron 2

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Indian, Malay
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

Nadkarni A, Gorakshakar A, Surve R, Sawant P, Phanasgaonkar S, Nair S, Ghosh K, Colah RB, Hematological and molecular analysis of novel and rare beta-thalassemia mutations in the Indian population., Hemoglobin, 33(1), 59-65, 2009

Microattributions

A/A	Contributor(s)	Date	Comments
1	Mohd Yasin, Norafiza	2020-10-20	Report of an update.

Created on 2010-06-16 16:13:15, Last reviewed on 2021-10-20 14:56:11 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-05-02 09:19:48	The IthaGenes Curation Team	Reviewed. Common name corrected.
4	2021-10-20 14:56:11	The IthaGenes Curation Team	Reviewed. Contributor, link and origin added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.