IthaID: 21

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Variant of Uncertain Significance
Common Name: -31 (A>C) HGVS Name: HBB:c.-81A>C
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GGGAGGGCAGGAGCCAGGGCTGGGC [A>C] TAAAAGTCAGGGCAGAGCCATCTAT (Strand: -)

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β+
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70514
Size: 1 bp
Located at: β
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Luo S, Chen X, Zeng D, Tang N, Yuan D, Zhong Q, Mao A, Xu R, Yan T, The value of single-molecule real-time technology in the diagnosis of rare thalassemia variants and analysis of phenotype-genotype correlation., J Hum Genet, 67(4), 183-195, 2022
  2. YaXuan Cao, JianMing Luo, Identification of two novel β-globin gene mutations HBB: exon3del, HBB: c.-81A>C, Hematology, 28(1), 2265723, 2023
Created on 2010-06-16 16:13:14, Last reviewed on 2023-11-21 10:19:08 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.