IthaID: 2098
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs9389268 | HGVS Name: | NC_000006.12:g.135098493A>G |
Context nucleotide sequence:
GCTGAGATTACAGGCGCATGCAACC [A/G] CACCCGACTAATTTTTTGTGTTTTA (Strand: +)
Also known as:
Comments: SNP associated with HbF levels in the African American Cooperative Study of Sickle Cell Disease (CSSCD) and in sickle cell disease (SCD) cohorts from Brazil. SNP associated with disease severity and HbF levels in Indian SCD patients.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NT_025741.15 |
| Locus Location: | N/A |
| Size: | 1 bp |
| Located at: | HBS1L-MYB |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Brazilian, African American, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008
- Upadhye D, Jain D, Trivedi Y, Nadkarni A, Ghosh K, Colah R, Influence of single nucleotide polymorphisms in the BCL11A and HBS1L-MYB gene on the HbF levels and clinical severity of sickle cell anaemia patients., Ann. Hematol. , 95(7), 1201-3, 2016
Created on 2013-09-13 13:45:37,
Last reviewed on 2018-11-20 17:26:50 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.