IthaID: 2095
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7776054 | HGVS Name: | NC_000006.12:g.135097778A>G |
Context nucleotide sequence:
TTTGTAATTTGTGTTCTGCTTCTAC [A/G] ATAGACATTTTTCATGTCATTAGAT (Strand: +)
Also known as:
Comments: SNP associated with HbF level variation in the Cooperative Study of Sickle Cell Disease (CSSCD) and in a sickle cell disease cohort from Brazil. SNP associated with HbA2 levels in individuals from the SardiNIA study.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NT_025741.15 |
| Locus Location: | 39588373 |
| Size: | 1 bp |
| Located at: | HBS1L-MYB |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Brazilian, Sardinian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008
- Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, Mulas A, Perseu L, Barella S, Porcu E, Pistis G, Pitzalis M, Pala M, Menzel S, Metrustry S, Spector TD, Leoni L, Angius A, Uda M, Moi P, Thein SL, Galanello R, Abecasis GR, Schlessinger D, Sanna S, Cucca F, Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels., Nat. Genet. , 47(11), 1264-71, 2015
Created on 2013-09-12 11:51:55,
Last reviewed on 2019-07-04 16:12:27 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.