IthaID: 2094
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs28384513 | HGVS Name: | NG_012002.1:g.4828A>C |
Context nucleotide sequence:
AGGAACCAAATTTGGAAAATAATCC [A/C] GAACGCTGGCGTAGGTAGCTCAAGG (Strand: -)
Also known as:
Comments: SNP associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD) and in sickle cell disease cohorts from Brazil and Cameroon.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 6 |
|---|---|
| Locus: | NG_012002.1 |
| Locus Location: | 4828 |
| Size: | 1 bp |
| Located at: | HBS1L |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Brazilian, Cameroonian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008
- Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010
- Cardoso GL, Diniz IG, Silva AN, Cunha DA, Silva Junior JS, Uchôa CT, Santos SE, Trindade SM, Cardoso Mdo S, Guerreiro JF, DNA polymorphisms at BCL11A, HBS1L-MYB and Xmn1-HBG2 site loci associated with fetal hemoglobin levels in sickle cell anemia patients from Northern Brazil., Blood Cells Mol. Dis. , 53(4), 176-9, 2014
- Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014
Created on 2013-09-12 11:37:57,
Last reviewed on 2016-05-17 18:17:38 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.