IthaID: 209
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS II-535 - CD 108 (+23, -310, +28) | HGVS Name: | HBB:c.[316-300_327delinsCAGGTGCCATCTGTCACCCTTTTCTTTG;316-316_316-315insAATATATTTTTAATATACTTTTT] |
| Hb Name: | Hb Jambol | Protein Info: | β nts 1046 - 1357 deleted AND nts AATATATTTTTAATATACTTTTT inserted between nts 1030 and 1031 of β AND nts CAGGTGCCATCTGTCACCCTTTTCTTTG inserted between nts 1045 and 1358 of β |
Context nucleotide sequence:
GCTTTCTTCTTTTAATATACTTTTT [-/AATATATT] TGTTTATCTTATTTCTAATACTTTC (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | Dominant |
| Stability: | Unstable |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71590 |
| Size: | 310 bp |
| Located at: | β |
Other details
| Type of Mutation: | Insertion & Deletion |
|---|---|
| Ethnic Origin: | Bulgarian |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Efremov GD, Simjanovska L, Plaseska-Karanfilska D, Stanojevic E, Petkov GH, Hb Jambol: a new hyperunstable hemoglobin causing severe hemolytic anemia., Acta haematologica, 117(1), 1-7, 2007
- Efremov GD, Dominantly Inherited beta-Thalassemia., Hemoglobin , 31(2), 193-207, 2007
Created on 2010-06-16 16:13:15,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.