
IthaID: 2084
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 51 (CTC>CGC) | HGVS Name: | NG_013087.1:g.6126T>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
CCTCCTGACCCCACGGAGCCGCCCC [T/G] CCACGTGAAGTCTGAGGACCAGCCC (Strand: -)
Comments: Protein change: L51R
External Links
No available links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | Increased expression for Aγ or Gγ |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 19 |
|---|---|
| Locus: | NG_013087.1 |
| Locus Location: | 6126 |
| Size: | 1 bp |
| Located at: | KLF1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Vietnamese |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Gallienne AE, Dréau HM, Schuh A, Old JM, Henderson S, Ten novel mutations in the erythroid transcription factor KLF1 gene associated with increased fetal hemoglobin levels in adults., Haematologica , 97(3), 340-3, 2012
Created on 2013-06-28 13:11:17,
Last reviewed on 2014-03-20 10:38:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.