IthaID: 2076


Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: CD 54-57 (-11bp): (-GAAGTCTGAGG) HGVS Name: NG_013087.1:g.6133_6143delGAAGTCTGAGG

Context nucleotide sequence:
ACCCCACGGAGCCGCCCCTCCACGT [GAAGTCTGAGG/-] ACCAGCCCGGGGAGGAAGAGGACGA (Strand: -)

Also known as:

Comments: Protein change: K54PfsX9

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

No available links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 6133
Size: 11 bp
Located at: KLF1
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: White British
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Gallienne AE, Dréau HM, Schuh A, Old JM, Henderson S, Ten novel mutations in the erythroid transcription factor KLF1 gene associated with increased fetal hemoglobin levels in adults., Haematologica , 97(3), 340-3, 2012
Created on 2013-06-28 12:58:39, Last reviewed on 2014-03-20 11:18:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.