IthaID: 2074
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7606173 | HGVS Name: | NG_011968.1:g.60183C>G |
Context nucleotide sequence:
CACTGAAGGCTGGGCACAGCCTTGG [C/G] GACCGCTCACAGGACATGCAGCAGT (Strand: +)
Also known as:
Comments: SNP in DHS +55. Associated with variation in F-cell number in individuals of African ancestry with sickle cell disease (SCD) from the Silent Infarct Transfusion (SIT) Trial cohort. Associated with HbF levels in normal subjects of Portuguese origin. The ancestral allele (G) is the major allele and is associated with higher F-cell levels. Associated with varying levels of HbF in sickle cell anaemia patients of African American (CSSCD study) and Saudi Arab (from Eastern Province) origin. Homozygosity for the G allele associated with increased HbF in African American Benin haplotype patients (study sample from CSSCD). The C allele associated with HbF in Kuwaiti patients with SCD, where the CC genotype strongly associated with low HbF levels. SNP was found in moderate LD (r^2 = 0.5) with rs6709302 [PMID: 34204365].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] F-cell numbers |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 60183 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African, African American, Saudi Arab, Portuguese, Kawaiti |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Bhatnagar P, Purvis S, Barron-Casella E, DeBaun MR, Casella JF, Arking DE, Keefer JR, Genome-wide association study identifies genetic variants influencing F-cell levels in sickle-cell patients., J. Hum. Genet. , 56(4), 316-23, 2011
- Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015
- Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015
- Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017
- Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021