IthaID: 2071

Context nucleotide sequence:
TTAACCTTCTTAGCACCCACAAACA [G/T] TTCCCTTCTGATATCTACTTGAACT (Strand: +)

Also known as:

Comments: SNP in DHS +62, an erythroid enhancer of BCL11A, and overlaps a peak of GATA1 and TAL1 transcription factor binding. The minor T allele for rs1427407 disrupts the consensus sequence enriched for GATA1 and TAL1 transcription factors. Associated with variation in F-cell number in healthy Northern Europeans (TwinsUK cohort). It strongly associated with HbF levels in individuals from Sardinia with β0-thalassaemia (n=316) and exhibited strong effect on the severity of the β-thalassaemia phenotype. It associated with varying levels of HbF in individuals with sickle cell anaemia (SCA) from the BABY HUG study (n=95), the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University (n=254). It also associated with HbF levels in SCA patients of Arab Indian and Saudi Arab (from both Eastern and Southwestern Provinces) origin. Associated with increased HbF levels as well as clinical outcomes (transfusion requirements) in pediatric patients with SCA from southeastern Brazil (n=250). It associated with HbF levels in individuals with SCA from Tanzania (East African descent, n=1213), as well as in a replication UK cohort of African Caribbean and/or West African descent (n=321). It associated with HbF levels in β-thalassaemia patients from Guangxi, Southern China (n=493). Homozygosity for the T allele associated with increased HbF in African American Benin haplotype patients (study sample from CSSCD). SNP associated with increased HbF and haemoglobin levels, as well as with lower platelet and reticulocyte counts in Nigerian patients with SCA (n=260). SNP significantly influenced baseline serum bilirubin (negative effect) in young patients with SCA (BABY HUG cohort) [PMID: 23606168]. It also associated with fewer pain events in the placebo-treated cohort and with even lower incidence of painful events for the HU-treated cohort [PMID: 23606168]. The BCL11A rs1427407 T variant has been associated with higher haemoglobin concentrations in cohorts with sickle cell anaemia (SCA) [PMID: 29879141, 23606168, 28868518]. It associated with HbF response to hydroxyurea in SCA patients from the University of Ibadan cohort (n=249) [PMID: 28868518]. Associations with specific SCA-related complications, such as vaso-occlusive crisis (VOC) frequency and stroke have shown conflicting results; e.g., the GG and GT genotypes associated with a higher number of reticulocytes and an elevated risk of VOC and stroke in Sudanese SCA patients [PMID: 30563311], but failed to reach statistical significance in three independent cohorts from the U.S. (University of Ibadan, University of Illinois at Chicago, Walk-PHaSST). Instead, when combining the absence of α-thalassemia with the absence of the BCL11A rs1427407 T variant to define a high risk group of SCA patients from all three cohorts, an increased risk for stroke history was detected [PMID: 28868518]. SNP associated with higher white blood cell counts in cohorts of sickle cell anaemia patients [PMID: 30563311, 28868518]. The T allele associated with HbF in Kuwaiti patients with SCD, where the TT genotype strongly associated with high HbF levels in the range of 20-30%. Haplotype analysis (rs1427407|rs10195871|rs7606173) showed that the TAG genotype had higher HbF levels (25.9%) compared to the GGC (15.3%) haplotype [PMID: 34204365].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007
2. Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012
3. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013
4. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013
5. Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015
6. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016
7. Yi S, Lai Y, Zuo Y, Chen Y, Qin H, Wei Y, Yang Q, Lin L, Luo J, Fan X, Zheng C, Common genetic polymorphisms at three loci affect HbF levels in β-thalassemia patients from Southern China., Blood Cells Mol. Dis. , 62(0), 22-23, 2016
8. Shaikho EM, Farrell JJ, Alsultan A, Sebastiani P, Steinberg MH, Genetic Determinants of HbF in Saudi Arabian and African Benin Haplotype Sickle Cell Anemia., Am. J. Hematol. , 2017
9. Saraf SL, Akingbola TS, Shah BN, Ezekekwu CA, Sonubi O, Zhang X, Hsu LL, Gladwin MT, Machado RF, Cooper RS, Gordeuk VR, Tayo BO, Associations of α-thalassemia and BCL11A with stroke in Nigerian, United States, and United Kingdom sickle cell anemia cohorts., Blood Adv, 1(11), 693-698, 2017
10. Adeyemo TA, Ojewunmi OO, Oyetunji IA, Rooks H, Rees DC, Akinsulie AO, Akanmu AS, Thein SL, Menzel S, A survey of genetic fetal-haemoglobin modifiers in Nigerian patients with sickle cell anaemia., PLoS ONE , 13(6), e0197927, 2018
11. Hassan FM, Al-Zahrani FM, BCL11A rs1427407 Genotypes in Sickle Cell Anemia Patients Undergo to Stroke Problems in Sudan., Korean J Fam Med, 40(1), 53-57, 2019
12. Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020
13. Akbulut-Jeradi N, Fernandez MJ, Al Khaldi R, Sukumaran J, Adekile A, Unique Polymorphisms at , and Loci Associated with HbF in Kuwaiti Patients with Sickle Cell Disease., J Pers Med, 11(6), , 2021