IthaID: 2070
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7599488 | HGVS Name: | NG_011968.1:g.67287G>A |
Context nucleotide sequence:
CAAAGAAGTTAGTCTCAGCCACCTG [C/T] GCATCCTCAATGCAAAAAGCTAAGT (Strand: +)
Also known as:
Comments: Associated with HbF levels is a subset of Cooperative Study of Sickle Cell Disease (CSSCD) participants. Associated with HbF level in Saudi W (benin haplotype) patients, but was not replicated in Saudi E (AI haplotype), Indian (AI haplotype) and a different subset of African-American (CSSD) patients with sickle cell anaemia (SCA, βS homozygotes). Associated with the hydroxyurea-induced increment in children with sickle cell disease (SCD), but not baseline or maximum HbF levels. The association was not replicated in a pediatric cohort of SCA from Brazil. Associated with HbF in Chinese Zhuang β-thalassemia intermedia patients.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Hb F levels [HP:0011904] [OMIM:141749] Hb F response to hydroxyurea |
Location
| Chromosome: | 2 |
|---|---|
| Locus: | NG_011968.1 |
| Locus Location: | 67287 |
| Size: | 1 bp |
| Located at: | BCL11A |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Galarneau G, Palmer CD, Sankaran VG, Orkin SH, Hirschhorn JN, Lettre G, Fine-mapping at three loci known to affect fetal hemoglobin levels explains additional genetic variation., Nat. Genet. , 42(12), 1049-51, 2010
- Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013
- Sebastiani P, Farrell JJ, Alsultan A, Wang S, Edward HL, Shappell H, Bae H, Milton JN, Baldwin CT, Al-Rubaish AM, Naserullah Z, Al-Muhanna F, Alsuliman A, Patra PK, Farrer LA, Ngo D, Vathipadiekal V, Chui DH, Al-Ali AK, Steinberg MH, BCL11A enhancer haplotypes and fetal hemoglobin in sickle cell anemia., Blood Cells Mol. Dis. , 54(3), 224-30, 2015
- Lai Y, Chen Y, Chen B, Zheng H, Yi S, Li G, Wei H, He S, Zheng C, Genetic Variants at BCL11A and HBS1L-MYB loci Influence Hb F Levels in Chinese Zhuang β-Thalassemia Intermedia Patients., Hemoglobin, 40(6), 405-410, 2016
- Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020