IthaID: 2065

Context nucleotide sequence:
TATCGTCTTTTGTGTTTAATTTCTT [C/T] CACAGAGCAGAATGATTCTGGGATT (Strand: +)

Also known as:

Comments: Associated with HbF levels in the general (non-anaemic) population of Sardinia (n=4305 in the initial screen, n=521 in the follow-up sample), as well as in Portuguese normal subjects. Associated with HbF levels in β-thalassaemia cohorts from Sardinia (n=126) and France (n=106), and in sickle cell disease (SCD) cohorts from Brasil (n=350), Cameroon (n=596), and Tunisia (n=148). Associated with increased HbF levels as well as clinical outcomes (transfusion requirements) in pediatric patients with SCA from southeastern Brazil (n=250). Associated with F-cell numbers and HbF levels in a SCD cohort from Tanzania (n=222). The association with HbF was replicated in the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University. The association was not replicated in Chinese β-thalassemia patients (n=312). SNP exhibited a modifying effect on HbF and clinical score in Indonesian HbE/β-thal patients. SNP significantly associated with fewer pain events at baseline and after HU treatment in young patients with SCA (BABY HUG cohort), as well as with higher Hb levels at study entry [PMID: 23606168]. SNP associated with baseline and hydroxyurea-induced HbF in pediatric sickle cell anaemia (HU-induced HbF significance is lost after Bonferroni correction) [PMID: 23409025].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Uda M, Galanello R, Sanna S, Lettre G, Sankaran VG, Chen W, Usala G, Busonero F, Maschio A, Albai G, Piras MG, Sestu N, Lai S, Dei M, Mulas A, Crisponi L, Naitza S, Asunis I, Deiana M, Nagaraja R, Perseu L, Satta S, Cipollina MD, Sollaino C, Moi P, Hirschhorn JN, Orkin SH, Abecasis GR, Schlessinger D, Cao A, Genome-wide association study shows BCL11A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia., Proc. Natl. Acad. Sci. U.S.A. , 105(5), 1620-5, 2008
2. Lettre G, Sankaran VG, Bezerra MA, Araújo AS, Uda M, Sanna S, Cao A, Schlessinger D, Costa FF, Hirschhorn JN, Orkin SH, DNA polymorphisms at the BCL11A, HBS1L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease., Proc. Natl. Acad. Sci. U.S.A. , 105(33), 11869-74, 2008
3. Badens C, Joly P, Agouti I, Thuret I, Gonnet K, Fattoum S, Francina A, Simeoni MC, Loundou A, Pissard S, Variants in genetic modifiers of β-thalassemia can help to predict the major or intermedia type of the disease., Haematologica , 96(11), 1712-4, 2011
4. He Y, Lin W, Luo J, Influences of genetic variation on fetal hemoglobin., Pediatr Hematol Oncol , 28(8), 708-17, 2011
5. Sheehan VA, Luo Z, Flanagan JM, Howard TA, Thompson BW, Wang WC, Kutlar A, Ware RE, , Genetic modifiers of sickle cell anemia in the BABY HUG cohort: influence on laboratory and clinical phenotypes., Am. J. Hematol. , 88(7), 571-6, 2013
6. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013
7. Wonkam A, Ngo Bitoungui VJ, Vorster AA, Ramesar R, Cooper RS, Tayo B, Lettre G, Ngogang J, Association of variants at BCL11A and HBS1L-MYB with hemoglobin F and hospitalization rates among sickle cell patients in Cameroon., PLoS ONE , 9(3), e92506, 2014
8. Green NS, Barral S, Emerging science of hydroxyurea therapy for pediatric sickle cell disease., Pediatr. Res. , 75(1), 196-204, 2014
9. Pereira C, Relvas L, Bento C, Abade A, Ribeiro ML, Manco L, Polymorphic variations influencing fetal hemoglobin levels: association study in beta-thalassemia carriers and in normal individuals of Portuguese origin., Blood Cells Mol. Dis. , 54(4), 315-20, 2015
10. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016
11. Rujito L, Basalamah M, Siswandari W, Setyono J, Wulandari G, Mulatsih S, Sofro AS, Sadewa AH, Sutaryo S, Modifying effect of XmnI, BCL11A, and HBS1L-MYB on clinical appearances: A study on β-thalassemia and hemoglobin E/β-thalassemia patients in Indonesia., Hematol Oncol Stem Cell Ther , 9(2), 55-63, 2016
12. Chaouch L, Moumni I, Ouragini H, Darragi I, Kalai M, Chaouachi D, Boudrigua I, Hafsia R, Abbes S, rs11886868 and rs4671393 of BCL11A associated with HbF level variation and modulate clinical events among sickle cell anemia patients., Hematology , 21(7), 425-9, 2016
13. Urio F, Nkya S, Rooks H, Mgaya JA, Masamu U, Zozimus Sangeda R, Mmbando BP, Brumat M, Mselle T, Menzel S, Luzzatto L, Makani J, F cell numbers are associated with an X-linked genetic polymorphism and correlate with haematological parameters in patients with sickle cell disease., Br J Haematol, 2020
14. Sales RR, Belisário AR, Faria G, Mendes F, Luizon MR, Viana MB, Functional polymorphisms of BCL11A and HBS1L-MYB genes affect both fetal hemoglobin level and clinical outcomes in a cohort of children with sickle cell anemia., Ann Hematol, 99(7), 1453-1463, 2020