IthaID: 2060

Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: 3'UTR +4 C>T HGVS Name: NG_000007.3:g.72022C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCTGGCCCACAAGTATCACTAAGCT [C/T] GCTTTCTTGCTGTCCAATTTCTAT (Strand: -)

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72022
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Kurdish, Vietnamese
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Xinh PT, Chuong HQ, Ha NTT, Tram HDB, Van Dong C, Thanh LVH, Hoa NTH, Nghia H, Binh NT, Dung PC, Vu HA, Spectrum of HBB gene mutations among 696 β-thalassemia patients and carriers in Southern Vietnam., Mol Biol Rep, 49(4), 2601-2606, 2022
Created on 2013-06-27 14:21:33, Last reviewed on 2022-05-13 13:04:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.