IthaID: 2056
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | IVS II-666 (C>T) | HGVS Name: | HBB:c.316-185C>T |
Context nucleotide sequence:
TTCTGGGTTAAGGCAATAGCAATAT [C/T] TCTGCATATAAATATTTCTGCATAT (Strand: -)
Also known as:
Comments: Neutral polymorphism used in high-density β-locus and genome-wide SNP mapping [PMID: 18829352]. Found in both a heterozygous and homozygous state in the population of Odisha State, India. No hematologic or phenotypic data reported [PMID: 24099628].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71705 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Intron 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009
- Sahoo SS, Biswal S, Dixit M, Distinctive mutation spectrum of the HBB gene in an urban eastern Indian population., Hemoglobin , 38(1), 33-8, 2014
Created on 2013-06-27 13:07:38,
Last reviewed on 2019-05-31 10:26:01 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.