IthaID: 2050


Names and Sequences

Functionality: Neutral polymorphism
Common Name: CD 59 AAG>AAA [Lys>Lys] HGVS Name: NG_000007.3:g.70904G>A

Context nucleotide sequence:
CTGATGCTGTTATGGGCAACCCTAA [C/G/T] GTGAAGGCTCATGGCAAGAAAGTGC (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70904
Size: 1 bp
Located at: β
Specific Location: Exon 2

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Greek
Inheritance: Quantitative trait
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Publications / Origin

To the best of our knowledge, this is unpublished data. Please use with caution!

Created on 2013-06-27 12:45:57, Last reviewed on 2013-10-15 17:00:14 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.