IthaID: 2037
Names and Sequences
| Functionality: | Neutral polymorphism | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | -300 C>T | HGVS Name: | NG_000007.3:g.70205C>T |
Context nucleotide sequence:
AATTTTCTTATTACACAAATAAGAA [A/G] TTGATGCACTAAAAGTGGAAGAGTT (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Allele Phenotype: | Neutral |
|---|---|
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70205 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | N/A |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009
- Lam KW, Jiang P, Liao GJ, Chan KC, Leung TY, Chiu RW, Lo YM, Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia., Clin. Chem. , 58(10), 1467-75, 2012
Created on 2013-06-27 11:47:21,
Last reviewed on 2014-04-23 16:17:06 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.