IthaID: 2036


Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: -487 T>C HGVS Name: NG_000007.3:g.70076C>T

Context nucleotide sequence:
ACAGAATGGATGAAAACTCTACCTC [A/G] GTTCTAAGCATATCTTCTCCTTATT (Strand: -)

Also known as:

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70076
Size: 1 bp
Located at: β
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Publications / Origin

  1. Liu L, Muralidhar S, Singh M, Sylvan C, Kalra IS, Quinn CT, Onyekwere OC, Pace BS, High-density SNP genotyping to define beta-globin locus haplotypes., Blood Cells Mol. Dis. , 42(1), 16-24, 2009
  2. Lam KW, Jiang P, Liao GJ, Chan KC, Leung TY, Chiu RW, Lo YM, Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia., Clin. Chem. , 58(10), 1467-75, 2012
  3. Papasavva TE, Lederer CW, Traeger-Synodinos J, Mavrou A, Kanavakis E, Ioannou C, Makariou C, Kleanthous M, A minimal set of SNPs for the noninvasive prenatal diagnosis of β-thalassaemia., Ann. Hum. Genet. , 77(2), 115-24, 2013
Created on 2013-06-27 11:18:16, Last reviewed on 2014-04-23 16:18:29 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.