IthaID: 199

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	IVS II-1 (-G)	HGVS Name:	HBB:c.315+1delG
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GCACGTGGATCCTGAGAACTTCAGG [G/-] TGAGTCTATGGGACGCTTGATGTTT (Strand: -)

Also known as:

Comments: Found in a heterozygous state with mild anaemia in a German Caucasian family of Huguenot descent. Presented with thalassaemia intermedia in a proband with alpha-globin triplication. Absence of aberrant or unstable haemoglobin (Hb) fraction in biochemical Hb analyses.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
LOVD	ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β0 Dominant
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	71040
Size:	1 bp
Located at:	β
Specific Location:	Exon 2

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Splice junction (mRNA Processing)
Ethnic Origin:	German
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Lahr G, Brintrup J, Over S, Feurle GE, Debatin KM, Kohne E, Codon 104(-G), a dominant beta0-thalassemia-like phenotype in a German Caucasian family is associated with mild chronic hemolytic anemia but influenced in severity by co-inherited genetic factors., Haematologica , 92(9), 1264-5, 2007

Created on 2010-06-16 16:13:15, Last reviewed on 2021-12-06 09:22:52 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2019-11-11 09:33:01	The IthaGenes Curation Team	Reviewed. HGVS name, Context sequence and Location corrected. dbSNP link removed. Comment added.
4	2019-11-11 11:13:29	The IthaGenes Curation Team	Reviewed. dbSNP link added.
5	2021-12-06 09:22:15	The IthaGenes Curation Team	Reviewed. HGVS and common names, corrected.
6	2021-12-06 09:22:52	The IthaGenes Curation Team	Reviewed. Effect on gene corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.