IthaID: 198


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 100 (-CC,+TCTGAGAACTT) >158aa HGVS Name: HBB:c.301_302delCCinsTCTGAGAACTT
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GCACTGTGACAAGCTGCACGTGGAT [CC/TCTGAGA] TGAGAACTTCAGGGTGAGTCTATGG (Strand: -)

Also known as:

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:β0
Dominant
Stability: Hyperunstable
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71025
Size: 3 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: S. African
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

Publications / Origin

  1. Williamson D, Brown KP, Langdown JV, Baglin TP, Mild thalassemia intermedia resulting from a new insertion/frameshift mutation in the beta-globin gene., Hemoglobin, 21(6), 485-93, 1997
Created on 2010-06-16 16:13:15, Last reviewed on 2018-04-25 17:12:45 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.