IthaID: 195


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 93/94 (+TG) HGVS Name: HBB:c.282_283dupTG
Hb Name: Hb Agnana Protein Info: β 94(+TG); modified C-terminal sequence

Context nucleotide sequence:
GCCACACTGAGTGAGCTGCACTGTG [-/TG] ACAAGCTGCACGTGGATCCTGAGAA (Strand: -)

Also known as:

Comments: Heterozygous individual with a thalassemia intermedia-like phenotype born from normal parents, requiring regular transfusions. Large inclusion bodies detected.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Thalassaemia dominant
Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71006
Size: 2 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: S. Italian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Ristaldi MS, Pirastu M, Murru S, Casula L, Loudianos G, Cao A, Sciarratta GV, Agosti S, Parodi MI, Leone D, A spontaneous mutation produced a novel elongated beta-globin chain structural variant (Hb Agnana) with a thalassemia-like phenotype., Blood, 75(6), 1378-9, 1990
Created on 2010-06-16 16:13:15, Last reviewed on 2023-08-09 10:17:36 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.