IthaID: 189
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 88 (+T) | HGVS Name: | HBB:c.266dupT |
| Hb Name: | N/A | Protein Info: | β 88(+T); modified C-terminal sequence: (88)Leu-(89)Glu-COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ACCTCAAGGGCACCTTTGCCACACT [-/T] GAGTGAGCTGCACTGTGACAAGCTG (Strand: -)
Comments: Found in a heterozygous state in one person of Asian Indian origin. The insertion of a nt T in codon 88 creates a shift in the reading frame with a premature stop codon at codon 90 (TGA).
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70990 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Asian Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Varawalla NY, Old JM, Weatherall DJ, Rare beta-thalassaemia mutations in Asian indians., British journal of haematology, 79(4), 640-4, 1991
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-13 14:04:55 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.