IthaID: 185
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 82/83 (-G) | HGVS Name: | HBB:c.251delG |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCTGGCTCACCTGGACAACCTCAAGG [-/G] CACCTTTGCCACACTGAGTGAGCT (Strand: -)
Also known as:
Comments: Found in an Azerbaijanian patient with β0-thalassaemia [PMID: 2525253]. Found in three different alleles of unrelated patients with β-thalassaemia major from Azerbaijan [PMID: 1483699]. Found in seven members of two families of Czech decent [PMID: 1740317]. Found in a Yugoslavian family of Croatian nationality with a heterozygosity for β-thalassaemia [PMID: 1517107]. The deletion of a nt G in codons 82/83 changes the reading frame with a stop codon at codon 88 resulting in a premature termination of translation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70975 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Azerbaijanian, Czech, Croatian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Schwartz EI, Gol'tsov AA, Kaboev OK, Alexeev AA, Solovyev GYa , Surin VL, Lukianenko AV, Vinogradov SV, Berlin YuA , A novel frameshift mutation causing beta-thalassaemia in Azerbaijan., Nucleic acids research, 17(10), 3997, 1989
- Indrak K, Brabec V, Indrakova J, Chrobak L, Sakalova A, Jarosova M, Cermak J, Fei YJ, Kutlar F, Gu YC, Molecular characterization of beta-thalassemia in Czechoslovakia., Human genetics, 88(4), 399-404, 1992
- Cürük MA, Yüregir GT, Asadov CD, Dadasova T, Gu LH, Baysal E, Gu YC, Ribeiro ML, Huisman TH, Molecular characterization of beta-thalassemia in Azerbaijan., Human genetics, 90(4), 417-9, 1992
- Jankovic L, Dimovski AJ, Efremov GD, Juricic D, A mutation of CDS 82/83 (-G) observed in a Yugoslavian family with a heterozygosity for beta-thalassemia., Hemoglobin, 16(4), 291-4, 1992