IthaID: 183
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 80/81 (-C) | HGVS Name: | HBB:c.244delC |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GATGGCCTGGCTCACCTGGACAAC [-/C] TCAAGGGCACCTTTGCCACACTGA (Strand: -)
Also known as:
Comments: Loss of nt C between codons 80 and 81 generates a frameshift with a nonsense codon at codon 88 (TGA) terminating translation. Found in a heterozygous state.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70968 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Iranian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Feleki X, Najmabadi H, Karimi-Nejad R, Christopoulos G, Kleanthous M, Identification of a novel beta0-thalassemia mutation, codons 80/81 (-C), in an Iranian family., Hemoglobin, 24(4), 319-21, 2000
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-07 09:47:56 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.