IthaID: 181


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 76 (-C) HGVS Name: HBB:c.230delC
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
CTCGGTGCCTTTAGTGATGGCCTGG [-/C] TCACCTGGACAACCTCAAGGGCACC (Strand: -)

Also known as:

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70954
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

Frequencies

Publications / Origin

  1. Di Marzo R, Dowling CE, Wong C, Maggio A, Kazazian HH, The spectrum of beta-thalassaemia mutations in Sicily., British journal of haematology, 69(3), 393-7, 1988
  2. Giambona A, Lo Gioco P, Marino M, Abate I, Di Marzo R, Renda M, Di Trapani F, Messana F, Siciliano S, Rigano P, The great heterogeneity of thalassemia molecular defects in Sicily., Human genetics, 95(5), 526-30, 1995
Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.