
IthaID: 177
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 71/72 (+A) | HGVS Name: | HBB:c.217dupA |
Hb Name: | N/A | Protein Info: | β 72(+A); modified C-terminal sequence: (72)Lys-COOH |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGCAAGAAAGTGCTCGGTGCCTTT [-/A] AGTGATGGCCTGGCTCACCTGG (Strand: -)
Comments: The introduction of a nt A between codons 71 and 72 (TTTAGT>TTTAAGT) results in a frameshift with a nonsense codon at codon 73 (TGA) and premature termination of translation.
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70941 |
Size: | 1 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Cheng TC, Orkin SH, Antonarakis SE, Potter MJ, Sexton JP, Markham AF, Giardina PJ, Li A, Kazazian HH, beta-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects., Proceedings of the National Academy of Sciences of the United States of America, 81(9), 2821-5, 1984
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-12 16:26:35 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.