IthaID: 176


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 71 (+T) HGVS Name: HBB:c.216dupT
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
TGGCAAGAAAGTGCTCGGTGCCTTT [-/T] AGTGATGGCCTGGCTCACCTGGACA (Strand: -)

Also known as:

Comments: Found in two members of a family; in a heterozygous state in the father and in combination with HBB:c.316-197C>T in his son. The introduction of a nt T between codons 71 and 72 (TTTAGT>TTTTAGT) results in a frameshift with a nonsense codon at codon 72 (TGA) and premature termination of translation.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70940
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Chan V, Chan TK, Todd D, A new codon 71 (+T) mutant resulting in beta zero thalassemia., Blood, 74(6), 2304, 1989
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 10:15:52 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.