IthaID: 175
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 67 (-TG) | HGVS Name: | HBB:c.203_204delGT |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TAAGGTGAAGGCTCATGGCAAGAAAG [-/TG] CTCGGTGCCTTTAGTGATGGCCTG (Strand: -)
Also known as:
Comments: Found in combination with a deletion variant in a Filipino proband presenting with β-thalassaemia major.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70927 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Filipino |
| Molecular mechanism: | Altered heme pocket |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Eng B, Chui DH, Saunderson J, Olivieri NF, Waye JS, Identification of two novel beta zero-thalassemia mutations in a Filipino family: frameshift codon 67 (-TG) and a beta-globin gene deletion., Human mutation, 2(5), 375-9, 1993
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-11 15:03:16 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.