IthaID: 173


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 64 (-G) HGVS Name: HBB:c.194delG
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
GGCAACCCTAAGGTGAAGGCTCATG [-/G] CAAGAAAGTGCTCGGTGCCTTTAG (Strand: -)

Also known as:

Comments: Found as a novel mutation in a Swiss patient. The loss of a nt G from codon 64 changes the reading frame with a stop codon at codon 88 resulting in a premature termination of translation.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70918
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Swiss
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Chehab FF, Winterhalter KH, Kan YW, Characterization of a spontaneous mutation in beta-thalassemia associated with advanced paternal age., Blood, 74(2), 852-4, 1989
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-11 11:10:53 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.