IthaID: 163


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 54/55 (+A) HGVS Name: HBB:c.166dupA
Hb Name: N/A Protein Info: β 55(+A); modified C-terminal sequence: (55)Asn-Gly-Gln-(58)Pro-COOH

Context nucleotide sequence:
GGATCTGTCCACTCCTGATGCTGTT [-/A] ATGGGCAACCCTAAGGTGAAGGCTC (Strand: -)

Also known as:

Comments: Found in a heterozygous state in one individual from Maharashtra, Bombay region, during caste screening. The introduction of a nt A between codons 54 and 55 (GTTATG>GTTAATG) results in a frameshift with a nonsense codon at codon 59 (TAA) and premature termination of translation.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70890
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Asian Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Garewal G, Fearon CW, Warren TC, Marwaha N, Marwaha RK, Mahadik C, Kazazian HH, The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci., British journal of haematology, 86(2), 372-6, 1994
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 16:25:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.