IthaID: 1573

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
CCCATGGGTTGGCCAGCCTTGCCTT [A/G] ACCAATAGCCTTGACAAGGCAAACT (Strand: -)

Comments: HPFH mutation, 7-33% of HbF in individuals carrying beta-thalassaemia mutations. Possibly disrupts binding site (TGACCA) of BCL11A transcriptional repressor.

Heterozygous records (preview in IthaPhen)

1. Collins FS, Metherall JE, Yamakawa M, Pan J, Weissman SM, Forget BG, A point mutation in the A gamma-globin gene promoter in Greek hereditary persistence of fetal haemoglobin., Nature, 313(6000), 325-6, 1985
2. Gelinas R, Endlich B, Pfeiffer C, Yagi M, Stamatoyannopoulos G, G to A substitution in the distal CCAAT box of the A gamma-globin gene in Greek hereditary persistence of fetal haemoglobin., Nature, 313(6000), 323-5, 1985
3. Huang HJ, Stoming TA, Harris HF, Kutlar F, Huisman TH, The Greek A gamma beta+-HPFH observed in a large black family., American journal of hematology, 25(4), 401-8, 1987
4. Ottolenghi S, Camaschella C, Comi P, Giglioni B, Longinotti M, Oggiano L, Dore F, Sciarratta G, Ivaldi G, Saglio G, A frequent A gamma-hereditary persistence of fetal hemoglobin in northern Sardinia: its molecular basis and hematologic phenotype in heterozygotes and compound heterozygotes with beta-thalassemia., Human genetics, 79(1), 13-7, 1988
5. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020