IthaID: 1572


Names and Sequences

Functionality: Globin gene causative mutation
Common Name: -158 C>T HGVS Name: HBG1:c.-211C>T
Hb Name: N/A Protein Info: N/A

Context nucleotide sequence:
AATGCAAATATCTGTCTGAAACGGT [C/T] CCTGGCTAAACTCCACCCATGGGTT (Strand: -)

Also known as: Cretan non-deletional HPFH

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47601
Size: 1 bp
Located at:
Specific Location: Promoter

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: Greek
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Publications / Origin

  1. Patrinos GP, Kollia P, Loutradi-Anagnostou A, Loukopoulos D, Papadakis MN, The Cretan type of non-deletional hereditary persistence of fetal hemoglobin [A gamma-158C-->T] results from two independent gene conversion events., Human genetics, 102(6), 629-34, 1998
Created on 2010-06-16 16:13:17, Last reviewed on 2013-10-15 17:28:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.