IthaID: 1572
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -158 C>T | HGVS Name: | HBG1:c.-211C>T |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
AATGCAAATATCTGTCTGAAACGGT [C/T] CCTGGCTAAACTCCACCCATGGGTT (Strand: -)
Also known as: Cretan non-deletional HPFH
Comments: Reported to lead to 3-5% of HbF in heterozygous carriers. Disruption of the -158 binding site via CRISPR-Cas9 induced HbF expression in adult HUDEP-2 erythroid cells [PMID: 32917636].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 47601 |
| Size: | 1 bp |
| Located at: | Aγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Patrinos GP, Kollia P, Loutradi-Anagnostou A, Loukopoulos D, Papadakis MN, The Cretan type of non-deletional hereditary persistence of fetal hemoglobin [A gamma-158C-->T] results from two independent gene conversion events., Human genetics, 102(6), 629-34, 1998
- Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020
Created on 2010-06-16 16:13:17,
Last reviewed on 2021-08-19 14:10:41 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.