IthaID: 1560
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -114 C>A | HGVS Name: | HBG2:c.-167C>A |
| Hb Name: | N/A | Protein Info: | N/A |
| Also known as: | Algerian non-deletional HPFH |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
ATGGGTTGGCCAGCCTTGCCTTGAC [C/A] AATAGCCTTGACAAGGCAAACTTGA (Strand: -)
Comments: HPFH mutation, 1-11% of HbF in individuals carrying beta-thalassaemia mutations. Disrupts binding site (TGACCA) of BCL11A transcriptional repressor.
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 42721 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Algerian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Zertal-Zidani S, Merghoub T, Ducrocq R, Gerard N, Satta D, Krishnamoorthy R, A novel C-->A transversion within the distal CCAAT motif of the Ggamma-globin gene in the Algerian Ggammabeta+-hereditary persistence of fetal hemoglobin., Hemoglobin, 23(2), 159-69, 1999
- Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020
Created on 2010-06-16 16:13:17,
Last reviewed on 2020-10-08 13:41:44 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.