
IthaID: 156
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
---|---|---|---|
Common Name: | CD 47/48 (+ATCT) | HGVS Name: | HBB:c.143_146dupATCT |
Hb Name: | N/A | Protein Info: | N/A |
Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GGTTCTTTGAGTCCTTTGGGGATCT [-/ATCT] GTCCACTCCTGATGCTGTTATGGGC (Strand: -)
Comments: Found in one Punjabi Indian patient [PMID: 8199027]. Found in members of a Sikh family from United Arab Emirates. The proband was compound heterozygote for this deletion and a β0 allele (HBB:c.174_175insC), whereas his father and sisten had beta-thalassaemia trait [PMID: 7558874].
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | β-thalassaemia |
Allele Phenotype: | β0 |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 70867 |
Size: | 4 bp |
Located at: | β |
Specific Location: | Exon 2 |
Other details
Type of Mutation: | Point-Mutation(Insertion) |
---|---|
Effect on Gene/Protein Function: | Frameshift (Translation) |
Ethnic Origin: | Asian Indian |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Garewal G, Fearon CW, Warren TC, Marwaha N, Marwaha RK, Mahadik C, Kazazian HH, The molecular basis of beta thalassaemia in Punjabi and Maharashtran Indians includes a multilocus aetiology involving triplicated alpha-globin loci., British journal of haematology, 86(2), 372-6, 1994
- el-Kalla S, Mathews AR, A novel frameshift mutation causing beta-thalassemia in a Sikh., Hemoglobin, 19(3), 183-9, 1995
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-12 12:50:29 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.