IthaID: 1558
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | -175 T>C | HGVS Name: | HBG2:c.-228T>C |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CTTCCCCACACTATCTCAATGCAAA [C/T] ATCTGTCTGAAACGGTCCCTGGCTA (Strand: -)
Also known as: Black/Sardinian/British non-deletional HPFH
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | HPFH |
|---|---|
| Hemoglobinopathy Subgroup: | HPFH |
| Allele Phenotype: | HPFH |
| Associated Phenotypes: | Hb F levels [HP:0011904] [OMIM:141749] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 42660 |
| Size: | 1 bp |
| Located at: | Gγ |
| Specific Location: | Promoter |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | African |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Friedman S, Schwartz E, Hereditary persistence of foetal haemoglobin with beta-chain synthesis in cis position (Ggamma-beta+-HPFH) in a negro family., Nature, 259(5539), 138-40, 1976
Created on 2010-06-16 16:13:17,
Last reviewed on 2013-10-15 17:28:32 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.