IthaID: 1555

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: -202 C>G HGVS Name: HBG2:c.-255C>G
Hb Name: N/A Protein Info: N/A
Also known as: Black non-deletional HPFH

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAAGCAGCAGTATCCTCTTGGGGGC [C/G] CCTTCCCCACACTATCTCAATGCAA (Strand: -)

Comments: HPFH mutation, 14–24% of HbF in individuals carrying HBB*S mutation. Disrupts binding site (CCCCTTCCCC) of LRF transcriptional repressor.

External Links

Phenotype

Hemoglobinopathy Group: HPFH
Hemoglobinopathy Subgroup: HPFH
Allele Phenotype:HPFH
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 42633
Size: 1 bp
Located at:
Specific Location: Promoter

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Promoter (Transcription)
Ethnic Origin: African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Collins FS, Stoeckert CJ, Serjeant GR, Forget BG, Weissman SM, G gamma beta+ hereditary persistence of fetal hemoglobin: cosmid cloning and identification of a specific mutation 5' to the G gamma gene., Proceedings of the National Academy of Sciences of the United States of America, 81(15), 4894-8, 1984
  2. Akinbami AO, Campbell AD, Han ZJ, Luo HY, Chui DH, Steinberg MH, Hereditary Persistence of Fetal Hemoglobin Caused by Single Nucleotide Promoter Mutations in Sickle Cell Trait and Hb SC Disease., Hemoglobin , 40(1), 64-5, 2016
  3. Weber L, Frati G, Felix T, Hardouin G, Casini A, Wollenschlaeger C, Meneghini V, Masson C, De Cian A, Chalumeau A, Mavilio F, Amendola M, Andre-Schmutz I, Cereseto A, El Nemer W, Concordet JP, Giovannangeli C, Cavazzana M, Miccio A, Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype., Sci Adv . , 6(7), 0, 2020
Created on 2010-06-16 16:13:17, Last reviewed on 2020-10-08 13:05:50 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.