IthaID: 154

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 45/46 (+A)	HGVS Name:	HBB:c.138_139insA
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GACCCAGAGGTTCTTTGAGTCCTTT [-/A] GGGGATCTGTCCACTCCTGATGCTG (Strand: -)

Also known as:

Comments: Found in a heterozygous state in a female of Arabic origin. The insertion of a nt A in codons 45/46 creates a shift in the reading frame with a premature stop codon at codon 52. Not detected by HPLC.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

LOVD

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β+
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	70862
Size:	1 bp
Located at:	β
Specific Location:	Exon 1

Other details

Type of Mutation:	Point-Mutation(Insertion)
Effect on Gene/Protein Function:	Frameshift (Translation)
Ethnic Origin:	Arab
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Publications / Origin

Cornut G, Weng X, Robin L, Lavoie C, Marchand S, Soulières D, A new insertion mutation in the beta-globin gene [codons 45/46 (+A)] resulting in a beta-thalassemia minor phenotype., Hemoglobin, 31(3), 393-5, 2007

Created on 2010-06-16 16:13:15, Last reviewed on 2020-09-28 13:41:55 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2020-09-28 13:41:55	The IthaGenes Curation Team	Reviewed. HGVS name, Allele phenotype and Location corrected. DNA info and Comment added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.