IthaID: 154
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 45/46 (+A) | HGVS Name: | HBB:c.138_139insA |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GACCCAGAGGTTCTTTGAGTCCTTT [-/A] GGGGATCTGTCCACTCCTGATGCTG (Strand: -)
Also known as:
Comments: Found in a heterozygous state in a female of Arabic origin. The insertion of a nt A in codons 45/46 creates a shift in the reading frame with a premature stop codon at codon 52. Not detected by HPLC.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70862 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 1 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Arab |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Cornut G, Weng X, Robin L, Lavoie C, Marchand S, Soulières D, A new insertion mutation in the beta-globin gene [codons 45/46 (+A)] resulting in a beta-thalassemia minor phenotype., Hemoglobin, 31(3), 393-5, 2007
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-09-28 13:41:55 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.