IthaID: 152

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 45 (-T) HGVS Name: HBB:c.138delT
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTGGACCCAGAGGTTCTTTGAGTCCTT [-/T] GGGGATCTGTCCACTCCTGATGC (Strand: -)

Comments: Found in two members of a Pakistani family presenting with heterozygous beta-thal trait. Found in two unrelated Pakistani individuals having children with transfusion-dependent thalassaemia. The loss of nt T in codon 45 results in a frameshift with a stop codon at codon 60 (TGA) terminating translation.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70862
Size: 1 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Pakistani
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. el-Kalla S, Mathews AR, A novel beta-thalassemia mutation [codon 45(-T)] in a Pakistani family., Hemoglobin , 21(6), 499-503, 1997
  2. Hussain A, Ahmed S, Ali N, S Mailk H, Anees M, Chuahdry AH, Ahmed P, Rare β-Globin Gene Mutations in Pakistan., Hemoglobin , 41(2), 100-103, 2017
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-11 16:03:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.