IthaID: 152
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 45 (-T) | HGVS Name: | HBB:c.138delT |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TTGGACCCAGAGGTTCTTTGAGTCCTT [-/T] GGGGATCTGTCCACTCCTGATGC (Strand: -)
Also known as:
Comments: Found in two members of a Pakistani family presenting with heterozygous beta-thal trait. Found in two unrelated Pakistani individuals having children with transfusion-dependent thalassaemia. The loss of nt T in codon 45 results in a frameshift with a stop codon at codon 60 (TGA) terminating translation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70862 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Pakistani |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- el-Kalla S, Mathews AR, A novel beta-thalassemia mutation [codon 45(-T)] in a Pakistani family., Hemoglobin , 21(6), 499-503, 1997
- Hussain A, Ahmed S, Ali N, S Mailk H, Anees M, Chuahdry AH, Ahmed P, Rare β-Globin Gene Mutations in Pakistan., Hemoglobin , 41(2), 100-103, 2017
Created on 2010-06-16 16:13:15,
Last reviewed on 2019-11-11 16:03:39 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.