IthaID: 147


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 41/42 (-CTTT) HGVS Name: HBB:c.126_129delCTTT
Hb Name: N/A Protein Info: β 41 - 42 (-TTCT) or β 41 - 42 (-CTTT) or β 41 - 42 (-TCTT); modified C-terminal sequence

Context nucleotide sequence:
TGGTCTACCCTTGGACCCAGAGGTT [-/CTTT] GAGTCCTTTGGGGATCTGTCCACTC (Strand: -)

Also known as:

Comments: Also reported in literature as CD 41/42 -TTCT or -TCTT, which do not follow the HGVS Sequence Variant Nomeclature recommendations.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 70850
Size: 4 bp
Located at: β
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Chinese, SE Asian, Indian, Thai
Molecular mechanism: Altered heme pocket
Inheritance: Recessive
DNA Sequence Determined: No

Frequencies

Publications / Origin

  1. Kimura A, Matsunaga E, Takihara Y, Nakamura T, Takagi Y, Lin S, Lee H, Structural analysis of a beta-thalassemia gene found in Taiwan., The Journal of biological chemistry, 258(5), 2748-9, 1983
  2. Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984
  3. Panyasai S, Satthakarn S, Pornprasert S, Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease., Hemoglobin, 42(1), 54-57, 2018
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-21 17:04:51 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.