IthaID: 147
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 41/42 (-CTTT) | HGVS Name: | HBB:c.126_129delCTTT |
| Hb Name: | N/A | Protein Info: | β 41 - 42 (-TTCT) or β 41 - 42 (-CTTT) or β 41 - 42 (-TCTT); modified C-terminal sequence |
Context nucleotide sequence:
TGGTCTACCCTTGGACCCAGAGGTT [-/CTTT] GAGTCCTTTGGGGATCTGTCCACTC (Strand: -)
Also known as: CD 41/42 (-TTCT), CD 41/42 (-TCTT)
Comments: Also reported in literature as CD 41/42 -TTCT or -TCTT, which do not follow the HGVS Sequence Variant Nomeclature recommendations.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β0 |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 70850 |
| Size: | 4 bp |
| Located at: | β |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Chinese, SE Asian, Indian, Thai |
| Molecular mechanism: | Altered heme pocket |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Frequencies
Publications / Origin
- Kimura A, Matsunaga E, Takihara Y, Nakamura T, Takagi Y, Lin S, Lee H, Structural analysis of a beta-thalassemia gene found in Taiwan., The Journal of biological chemistry, 258(5), 2748-9, 1983
- Kazazian HH, Orkin SH, Antonarakis SE, Sexton JP, Boehm CD, Goff SC, Waber PG, Molecular characterization of seven beta-thalassemia mutations in Asian Indians., The EMBO journal, 3(3), 593-6, 1984
- Panyasai S, Satthakarn S, Pornprasert S, Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease., Hemoglobin, 42(1), 54-57, 2018
Created on 2010-06-16 16:13:15,
Last reviewed on 2021-12-15 11:47:43 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.