IthaID: 1467


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 23 (-GCT) HGVS Name: HBG1:c.70_72del
Hb Name: Hb F-Mauritius Protein Info: Aγ 23(B5) Ala->0

Context nucleotide sequence:
GTGGGGCAAGGTGAATGTGGAAGAT [GCT/-] GGAGGAGAAACCCTGGGAAGGTAGG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: γ-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 47881
Size: 3 bp
Located at:
Specific Location: Exon 1

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Publications / Origin

  1. Wajcman H, Ducrocq R, Promé D, Galactéros F, Hb F-Mauritius [A gamma 23 (B5) Ala deleted]: evidence for an identical hotspot for deletions in the various beta-like genes., Comptes rendus de l'Académie des sciences. Série III, Sciences de la vie, 318(10), 1065-71, 1995
Created on 2010-06-16 16:13:17, Last reviewed on 2023-08-04 13:06:30 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.