IthaID: 1444


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: CD 80 GAT>TAT [Asp>Tyr] HGVS Name: HBG2:c.241G>T
Hb Name: Hb F-Paulinia Protein Info: Gγ 80(EF4) Asp>Tyr

Context nucleotide sequence:
GGGAGATGCCATAAAGCACCTGGAT [A/G/T] ATCTCAAGGGCACCTTTGCCCAGCT (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: γ-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 43250
Size: 1 bp
Located at:
Specific Location: Exon 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Sardinian, African
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Publications / Origin

  1. Duarte DF, Albuquerque DM, Pereira Pinheiro VR, Ferreira Costa F, De Fátima Sonati M, Three new structural variants of fetal hemoglobin: Hb F-Campinas [Agamma g121(GH4)Glu --> Gln], Hb F-Paulinia [Ggamma 80(EF4)Asp --> Tyr] and Hb F-Joanopolis [Ggamma73(E17) Asp -->Ala]., Haematologica, 88(11), 1316-7, 2003
  2. Mereu P, Multineddu C, Sannai M, Pirastru M, Manca L, Masala B, Two abnormal fetal hemoglobins found in the Sardinian population: the new Hb F-Osilo [(A)gamma119(GH2)Gly-->Ser, GGC > AGC] and Hb F-Paulinia [(G)gamma80(EF4)Asp-->Tyr, GAT > TAT] already described in the Brazilian population., Hemoglobin, 33(6), 480-5, 2009
Created on 2010-06-16 16:13:17, Last reviewed on 2014-04-09 09:21:59 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.