IthaID: 1340


Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: N/A
Common Name: IVS II-1 G>A HGVS Name: HBD:c.315+1G>A
Hb Name: N/A Protein Info: δ nt 639 G>A

Context nucleotide sequence:
GCACGTGGATCCTGAGAACTTCAGG [A/G] TGAGTCCAGGAGATGCTTCACTTTT (Strand: -)

Also known as:

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: δ-thalassaemia
Allele Phenotype:δ0
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 63626
Size: 1 bp
Located at: δ
Specific Location: Intron 2

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African, Caribbean
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Publications / Origin

  1. Frischknecht H, Troxler H, Dutly F, Walker L, Hohenadel BA, Eng B, Waye JS, Characterization of three novel delta chain hemoglobin variants and two delta-thalassemia alleles., Hemoglobin , 34(4), 374-82, 2010
Created on 2010-06-16 16:13:17, Last reviewed on 2014-01-10 11:07:34 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.