IthaID: 1338
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 91 (+T) | HGVS Name: | HBD:c.275dupT |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GCACTTTTTCTCAGCTGAGTGAGC [-/T] GCACTGTGACAAGCTGCACGTGGA (Strand: -)
Also known as:
Comments: The insertion of an extra T nucleotide at codon 91, gives rise to a premature stop codon at position 94 leading to the silencing of the gene.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia |
| Allele Phenotype: | δ0 |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 63585 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Belgian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Losekoot M, Fodde R, Giordano PC, Bernini LF, A novel delta zero-thalassemia arising from a frameshift insertion, detected by direct sequencing of enzymatically amplified DNA., Human genetics, 83(1), 75-8, 1989
Created on 2010-06-16 16:13:17,
Last reviewed on 2021-12-03 12:42:24 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.