IthaID: 1324
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | -68 (C>T) | HGVS Name: | HBD:c.-118C>T |
Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
CCTCCCTGCTCCAGTGAGCAGGTTG [A/G] TTTAAGATAAGCAGGGTTTCATTAG (Strand: +)
Also known as:
Comments: SNP associated with δ-thalassaemia. SNP was found in sickle cell anaemia patients with the Saudi-Indian (SI) or Arab-Indian (AI) haplotype and high HbF levels. There is no evidence that this SNP regulates HBG expression.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | δ-thalassaemia |
Allele Phenotype: | δ+ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 11 |
---|---|
Locus: | NG_000007.3 |
Locus Location: | 63065 |
Size: | 1 bp |
Located at: | δ |
Specific Location: | Promoter |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Dutch |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Frequencies
Publications / Origin
- Bouva MJ, Harteveld CL, van Delft P, Giordano PC, Known and new delta globin gene mutations and their diagnostic significance., Haematologica, 91(1), 129-32, 2006
- Phylipsen M, Gallivan MV, Arkesteijn SG, Harteveld CL, Giordano PC, Occurrence of common and rare δ-globin gene defects in two multiethnic populations: thirteen new mutations and the significance of δ-globin gene defects in β-thalassemia diagnostics., Int J Lab Hematol , 33(1), 85-91, 2011
- Habara AH, Shaikho EM, Steinberg MH, Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents., Am. J. Hematol. , 2017
Created on 2010-06-16 16:13:17,
Last reviewed on 2019-07-03 09:33:08 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2010-06-16 16:13:17 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
3 | 2017-09-22 20:19:52 | The IthaGenes Curation Team | Reviewed. Mutation comment, DNA info, and Clinical phenotype sections updated. Referenced added. |
4 | 2017-09-22 20:20:39 | The IthaGenes Curation Team | Reviewed. Link added. |
5 | 2019-07-03 09:33:08 | The IthaGenes Curation Team | Reviewed. Phenotype corrected. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-12-03 11:48:06