IthaID: 1320
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 147 (+TA) | HGVS Name: | HBB:c.442_443dupTA |
| Hb Name: | Hb Monplaisir | Protein Info: | β 147(+TA); modified C-terminal sequence: (147)Tyr-Lys-Leu-Ala-Phe-Leu-Leu-Ser-Asn-Phe- | Tyr-(158)COOH |
Context nucleotide sequence:
TAATGCCCTGGCCCACAAGTATCACTA [-/TA] AGCTCGCTTTCTTGCTGTCCAAT (Strand: -)
Also known as:
Comments: Found in a heterozygous state in a male subject of Spanish origin with normal haematological parameters. Abnormal haemoglobin (Hb) identified on IEF and CE-HPLC. Normal oxygen affinity and isopropanol stability tests. No Heinz bodies detected on a brilliant cresyl blue preparation. Liquid chromatography MS/MS identified the peptide: the insertion (TA) at the normal stop codon (TAA) leads to a modified C-terminal sequence (147)YKLAFLLSNFY(158)COOH.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72016 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Spanish |
| Molecular mechanism: | Elongated globin |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Publications / Origin
- Joly P, Lacan P, Bererd M, Garcia C, Zanella-Cleon I, Becchi M, Aubry M, Couprie N, Francina A, Description of two new alpha variants: Hb Canuts [alpha85(F6)Asp-->His (alpha1)] and Hb Ambroise Pare [alpha117(GH5)Phe-->Ile (alpha2)]; two new beta variants: Hb Beaujolais [beta84(EF8)Thr-->Asn] and Hb Monplaisir [beta147 (Tyr-Lys-Leu-Ala-Phe-Phe-Leu-Leu-Ser-Asn-Phe-Tyr-158-COOH)] and one new delta variant: Hb (A2)North Africa [delta59(E3)Lys-->Met]., Hemoglobin, 33(3), 196-205, 2009
Created on 2010-06-16 16:13:17,
Last reviewed on 2019-11-12 12:13:09 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.