IthaID: 1319

Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 146/147 (+AC) HGVS Name: HBB:c.440_441dupAC
Hb Name: Hb Tak Protein Info: β 147(+AC); modified C-terminal sequence: (147)Thr-Lys-Leu- Ala-Phe-Leu-Leu-Ser-Asn-Phe-(157)Tyr-COOH
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAATGCCCTGGCCCACAAGTATCAC [-/AC] TAAGCTCGCTTTCTTGCTGTCCAAT (Strand: -)

Comments: Insertion of dinucleotide AC between codon 146 and nonsense codon 147 (TAA), causing the elongation of the β-chain by 11 amino acid residues at its C-terminus. The resulting haemoglobin Tak has high oxygen affinity, causing secondary polycythemia.

External Links

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72014
Size: 2 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Frequencies

Publications / Origin

  1. Hoyer JD, Wick MJ, Thibodeau SN, Viker KA, Conner R, Fairbanks VF, Hb Tak confirmed by DNA analysis: not expressed as thalassemia in a Hb Tak/Hb E compound heterozygote., Hemoglobin, 22(1), 45-52, 1998
Created on 2010-06-16 16:13:17, Last reviewed on 2019-11-12 16:35:03 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.