IthaID: 1306
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 145 (+CT) | HGVS Name: | HBB:c.436_437insCT |
| Hb Name: | Hb Cranston | Protein Info: | β 145(+CT); modified C-terminal sequence: (145)Ser-Ile-Thr-Lys-Leu- Ala-Phe-Leu-Leu-Ser-Asn-Phe-(157)Tyr-COOH |
Context nucleotide sequence:
GTGGCTAATGCCCTGGCCCACAAGT [-/CT] ATCACTAAGCTCGCTTTCTTGCTGT (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-chain variant |
| Allele Phenotype: | N/A |
| Stability: | Unstable |
| Oxygen Affinity: | Increased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72010 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Italaian |
| Molecular mechanism: | Elongated globin |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Bunn HF, Schmidt GJ, Haney DN, Dluhy RG, Hemoglobin Cranston, an unstable variant having an elongated beta chain due to nonhomologous crossover between two normal beta chain genes., Proceedings of the National Academy of Sciences of the United States of America, 72(9), 3609-13, 1975
Created on 2010-06-16 16:13:17,
Last reviewed on 2013-10-15 17:00:14 (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.