IthaID: 1290
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 142 (-CC) | HGVS Name: | HBB:c.429_430delCC |
| Hb Name: | Hb Uzes | Protein Info: | β 142 (-CC); modified C-terminal sequence: (142)Ala-Gln-Val-Ser-Leu-Ser-Ser-Leu-Ser-Cys- | Cys-Pro-Ile-Ser-Ile-Lys-Gly-Ser-Phe-Val- | Pro-(163)COOH |
| Also known as: |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GTGGCTGGTGTGGCTAATGCCCTGGC [-/CC] ACAAGTATCACTAAGCTCGCTTTC (Strand: -)
Comments: Found as a heterozygote in an elder proband of French Caucasian origin living in Brittany and presenting with normal haematological indices. The deletion generates a frameshift with elongation of the β-globin chain to 162 residues, yet no elongated β-globin chain or more complex species were detected by electrospray ionization mass spectrometry. No abnormal β-globin chain was observed in reversed phase HPLC. Also reported as a structural variant found in a hetrozygous state in a French proband, which was observed in reversed phase HPLC. The presence of two Cys residues in the elongated part may cause some polymerisation.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β0 |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72003 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | French |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Lacan P, Aubry M, Couprie N, Francina A, Two new beta0-thalassemic mutations: a deletion (-CC) at codon 142 or overlapping codons 142-143, and an insertion (+T) at codon 45 or overlapping codons 44-45/45-46 of the beta-globin gene., Hemoglobin, 31(2), 159-65, 2007