IthaID: 1290
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 142 (-CC) | HGVS Name: | HBB:c.429_430delCC |
| Hb Name: | Hb Uzes | Protein Info: | β 142 (-CC); modified C-terminal sequence: (142)Ala-Gln-Val-Ser-Leu-Ser-Ser-Leu-Ser-Cys- | Cys-Pro-Ile-Ser-Ile-Lys-Gly-Ser-Phe-Val- | Pro-(163)COOH |
Context nucleotide sequence:
GTGGCTGGTGTGGCTAATGCCCTGGC [-/CC] ACAAGTATCACTAAGCTCGCTTTC (Strand: -)
Also known as:
Comments: Found as a heterozygote in an elder proband of French Caucasian origin living in Brittany and presenting with normal haematological indices. The deletion generates a frameshift with elongation of the β-globin chain to 162 residues, yet no elongated β-globin chain or more complex species were detected by electrospray ionization mass spectrometry. No abnormal β-globin chain was observed in reversed phase HPLC. Also reported as a structural variant found in a hetrozygous state in a French proband, which was observed in reversed phase HPLC. The presence of two Cys residues in the elongated part may cause some polymerisation.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β0 |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72003 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | French |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Publications / Origin
- Lacan P, Aubry M, Couprie N, Francina A, Two new beta0-thalassemic mutations: a deletion (-CC) at codon 142 or overlapping codons 142-143, and an insertion (+T) at codon 45 or overlapping codons 44-45/45-46 of the beta-globin gene., Hemoglobin, 31(2), 159-65, 2007